888 575 9695        Contact Us        Sign in

Vector Sequences and Maps

Lucigen’s vector sequences are listed below as text files, in SnapGene format(), and as GenBank (gb) files.

Annotated maps and sequences of Lucigen’s vectors are available from the SnapGene website and can be viewed with the free SnapGene viewer. The PlasMapper web site also automatically generates and annotates plasmid maps using the plasmid DNA text sequences as input. Both viewers support an extensive array of display options. Plasmid maps may be rendered in PNG, JPG, SVG, and other formats.

pETite® Vectors

pETite® C-His Kan Vector (2235 bp) TXT pETite C-His Kan gb format
pETiteN-His Kan Vector (2235 bp) TXT pETite N-His Kan gb format
pETiteN-His Kan SUMO Vector (2535 bp) TXT pETite N-His SUMO Kan gb format

pME-HA Vector

pME-HA Vector TXT pME-HA (linearized) gb format

pRham™ Vectors

     
pRham C-His Kan Vector (2275 bp) TXT pRham C-His Kan gb format
pRham N-His Kan Vector (2275 bp) TXT pRham N-His Kan gb format
pRham N-His Kan SUMO Vector (2575 bp) TXT pRham N-His SUMO Kan gb format

pSol™ Vectors

His AFV TXT pSOL His AFV gb format
His Bla TXT pSOL His Bla gb format
His GST TXT pSOL His GST gb format
His mMBP TXT pSOL His mMBP gb format
His slyD TXT pSOL His slyD gb format
His SUMO TXT pSOL His SUMO gb format
His tsf TXT pSOL His tsf gb format
His TXT pSOL His gb format

pNGS FOS

pNGS FOS TXT pNGS FOS Circ pNGS FOS linear
EZ-Tn5™ <DHFR-1> [887 bp] TXT
EZ-Tn5™ <KAN-2> [1221 bp] TXT
EZ-Tn5™ <R6Kγori /KAN-2> [2001 bp] TXT
EZ-Tn5™ <T7 /KAN-2> [1248 bp] TXT
EZ-Tn5™ <TET-1> [1674 bp] TXT
pUC 3.4 TXT

 

The pEZSeq primers, Z-Rev and Z-For are identical to the M13 Forward and Reverse Primers:

  • AmpliScribe-AmpliScribe-Flash-DuraScribe-Transcriptional-Runoff-Template-Sequence-1381-bp
  • SL1: 5'-CAG TCC AGT TAC GCT GGA GTC
  • CL3: 5'-GTT GAT TGC AGT CCA GTT ACG CT
  • SR2: 5'-GGT CAG GTA TGA TTT AA A TGG TCA GT
  • Z-Rev (M13 Reverse (-48)): 5'-AGC GGA TAA CAA TTT CAC ACA GGA
  • Z-For (M13 Forward (-41)): 5'-CGC CAG GGT TTT CCC AGT CAC GAC
  • SR4: 5’–TTG ACC ATG TTG GTA TGA TTT–3’
  • NZ RevC: 5'- AAATGGTCAGTTAATCAGTTCT
  • pETiteT7 Forward (T7 Promoter): 5’–TAATACGACTCACTATAGGG–3’
  • pETite Reverse: 5’–CTCAAGACCCGTTTAGAGGC–3’
  • SUMO Forward: 5’–ATTCAAGCTGATCAGACCCCTGAA–3’

For other technical assistance, contact us.

Welcome to Lucigen!
Please tell us your location: